In one of the first pages of Dangerous Voyage to Alpha Centauri the psychologist Anna learns about the findings of immortality based on methods adjusting telomerase in cells:
“Professor, we are impressed by the methods you just demonstrated”, the reporter said, and turning to the viewers he said: “We have seen that telomerase–therapy will regenerate blood-vessels, thus preventing strokes. We learned that this therapy will even trigger a complete regeneration of our bodies. For the elderly, this therapy will perform what cosmetics have promised. This is, that our bodies will return to the youthfulness we had when we were in our twenties.”>
What are the facts about aging? What ideas support unlimited life?
Learn more about
(1.) Facts on aging
(2.) Immortal cells we all have
(3.) The clock of aging
(4.) Controlling this clock
(1.) Facts on aging - War of Molecules
1. According to the laws of physics there is a trend to level out any differences, for example differences in pressure, or temperature, or concentration. Thus, physicists would characterize life as a process in which differences are maintained. To keep up all kinds of differences a living system needs energy. In the eyes of physicists aging would indicate a break down in energy producing processes.
2. Differently biochemists describe aging as a process, in which vital molecules such as proteins will be changed in the course of time. Millions of these proteins turn the plane of light to the left due to an asymmetric atom of carbon within the protein. As we are used to prefer either our right hand or the left one, so protein-molecules work only with these left-handed molecules, which turn the plane of light to the left. But a simple change within the molecule could turn the plane of light to the right. This would make the protein ineffective or even dangerous. Thus, aging could be defined as a process of re-positioning groups within molecules.
3. Another reason of aging is described as the destruction of molecules such as water in our bodies. Only a small percentage of water molecules will decay in the course of time into aggressive products. These substances are called ‘free radicals’. They would combine with necessary substances to some fatal stuff. The older a being, the more defects have occurred in its lifetime and consequently it will suffer from the destructive actions of the aggressive free radicals. These destructions are manifested as aging and finally cause death.
4. For defense organisms fight these radicals with anti-oxidants. Long living beings as humans possess means to produce considerable amounts of anti-oxidants. The human body accomplishes this task with the help of vitamins or hormones among which melatonin is one to produce anti-oxidants and thus keeps back our bodies from aging. But as time goes on more and more free radicals escape the traps of anti-oxidants. They continue their destructive work visible as aging of the being.
5. Successful attacks of radicals on our genetic information system in our cells prove to be fatal. If you are working in a repair shop you know which parts of the equipment would fail after a certain time. Even if this part is still working well, you will replace it as you expect it will malfunction soon. So does our body. To avoid malfunction our body replaces all its components in its one hundred trillion cells according to the blueprint in the DNA of each cell. But in case free radicals have successfully attacked a DNA-molecule, wrong information will be produced which will prove disastrous over the course of time. Inevitable steps towards aging and death will result.
6. If you would say now, let us fight all these attacks on life, and then we could live much longer, I have to answer: You are wrong, my friend. If these attacks of molecules were the only factor of aging, all animals could live about the same number of years. But a mouse lives two years, a turtle a hundred years and protozoa could be immortal. It would be illogical if the attacks of free radicals should damage mice more frequently than protozoa.
As the life-time of different species varies, specific clocks must be installed in them which constitute their average living time. And these clocks of life must be a part of the species’ DNA in which all specific traits are encoded.
(2.)
Immortal Cells - we have them
1. Spermatogonia
Protozoa generally do not die. Humans, too, have cells that never die. They are called stem-cells. The spermatogonium of a male person for example will divide into a spermatogonium and a spermatocyte. Only the latter one will develop into a sperm-cell. Each spermatogonium itself keeps dividing, reproducing itself, and producing a spermatocyte with each division until the male person will die. Spermatogonia are immortal cells
2. Erythroblasts
Each red blood cell doesn’t live longer than four months. After this period it can no longer transport oxygen. So it will decay. In order to replace decayed red blood cells, in our red bone-marrow stem-cells live which are called erythroblasts. Whenever one erythroblast divides into two cells, one cell is a clone of this erythroblast while the other one will develop into a red blood cell and thus replace the decayed one. Our erythroblasts are immortal cells.
3. Other stem cells
In our skin we carry stem-cells. When dividing, again, the clone will stay a stem cell while the other one will change and will be pushed to the outside of our body and thus accomplish the protection of our body. Each of us repels eight grams of skin cells per day which have to be replaced by dermal stem cells.
In the same way stem-cells behave which form the inside layer of our intestines. They are exposed to aggressive substances in the digestive process. They die in a way of sacrificing themselves, but they get replaced by the division of stem-cells.
Similarly the division of stem-cells can be described in many other parts of our body where stem-cells exist. More than one hundred stem cells are known.
It’s a fact; each human has cells which lack the clock of life. They can divide unbounded and, thus, live forever.
(3.) The Clock of Aging
Each chromosome from which we have 46 in each of our 100 trillion cells consists of a great number of elements of only four different kinds. Many thousands of them are connected to each other in ever changing variation. These four elements are abbreviated with A (for adenine), C (for cytosine), G (for guanine) and T (for thymine) and are called nucleotides. A little section of one string of a chromosome might run as
.…ACCTATCGGGTACATGAATACG…. and so on, many hundred thousand times in ever changing variation. Hundreds of those elements in a certain order constitute information about a substance necessary for life, for example how insulin can be formed.
To grant stability of the DNS-molecule and to avoid mistakes, a parallel string is closely attached to each string within a chromosome. This is achieved by chemical bonds which allow, that A can only bind with T and G only with C:
….ACCTATCGGGTACATGAATACG…. is attached to
….TGGATAGCCCATGTACTTATGC…. as its parallel “security” string.
Molecules of phosphoric acid and of sugar-molecules, called des-oxy-ribose, organize the chemical bond between neighboring nucleotides of each string, but they have been omitted in this description for better understanding.
The structure of each chromosome is a helix consisting of two strings. It is also called DNA. (D stands for a sugar molecule, N for nucleotide and A for Acid.)
Look at a house being built of bricks of four different kinds. It could look like a shed or like a royal palace. The only difference is the number of stones and their arrangement to each other. Similar it is with the chromosomes of all beings on Earth. Their blue-prints consist of A, C, G, and T nucleotides, in ever different number and combination for each species.
But, at the end of each DNA of any living being you find repetitions of the code TTAGGG. At some beings you find these bits of TTAGGG many hundred times, at short living beings their number is rather limited. This combination does not carry the information for the production of any product as other assemblies on the chromosome do. As these groups are at the ends of each chromosome they are called telomeres (telos is Greek and means end).
Whenever a cell divides, several bits of TTAGGGs are cut off. This doesn’t harm the being, as TTAGGG doesn’t stand for the production of any substance. But when they are used up the chromosome and hence the cell can no more be replaced. The cells will become ineffective and will be destroyed by white blood bodies. The more cells will be lost, the more the being will age.
The clock of cellular aging resides in the ends of each chromosome.
(4.) Control the Clock of Aging – it isn’t all impossible
It was observed that in stem-cells the cut off telomeres will be replaced due to a product which is encoded in the chromosomes and which is called telomerase. In March 2007 Dr. Scott Cohen and his team at Children’s Medical Research Institute in Australia identified the human telomerase. As soon as telomerase is active, it will replace the cut off telomeres and thus eliminate the aging of this cell.
Telomerase is active in stem-cells.
But cells other than stem cells are known, in which telomerase is produced, perhaps by the destructive action of free radicals on the DNA. Of course, these are not normal cells. They are cancer cells.
After scientists have identified human telomerase they will research how to control its production. Then they will master the irregular budding of cells, called cancer. And they also will be able to restore the number of telomeres in each cell, thus stopping or even reversing the aging process.
More about longevity you can read in my thrilling novel, you can order here: ORDER
Further reading:
M. Fossel:Cells, Aging, and Human Disease, Oxford University Press New York, 2003
Scott Cohen et alii, Protein composition of catalytically active human telomerase from immortal cells, Science, 30 March 2007, Vol 315, no. 5820 pp. 1850-1853
http://en.wikipedia.org/wiki/Telomerase http://telomerase.asu.edu
|